| Primary Identifier | MGI:7388301 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Letmd1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 technology targeting exon 2 generated a 95 bp deletion (5â -CTTCAAAGCTTCACCTTTCTCCGAAGGCGGACGTGAAGAACTTGATTTCT TACGTGGTGACCAAGACAAGAGCGATTAACGGATCGTACCATCGT -3â) resulting in a frame shift and a premature stop codon and a knockout of isoform 1. |