|  Help  |  About  |  Contact Us

Allele : Letmd1<em1Etch> LETM1 domain containing 1; endonuclease-mediated mutation 1, Edward T Chouchani

Primary Identifier  MGI:7388301 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Letmd1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 technology targeting exon 2 generated a 95 bp deletion (5’ -CTTCAAAGCTTCACCTTTCTCCGAAGGCGGACGTGAAGAACTTGATTTCT TACGTGGTGACCAAGACAAGAGCGATTAACGGATCGTACCATCGT -3’) resulting in a frame shift and a premature stop codon and a knockout of isoform 1.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele