|  Help  |  About  |  Contact Us

Allele : Dp(11)2Smun duplication, Chr 11, Stefan Mundlos 2

Primary Identifier  MGI:7398591 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Modified regulatory region, Reporter Gene  Dp(11)2Smun
Strain of Origin  129P2/OlaHsd Is Recombinase  false
Is Wild Type  false
molecularNote  This duplication allele was created through cre-mediated interchromosomal recombination between loxP sites on two alleles: allele Igs44tm1(sb-SBlac)Smun containing an SBlac cassette at chr11:110989101-110989102 (GRCm39), and allele Igs45tm1(sb-SBlac)Smun containing an SBlac cassette at chr11:112544204-112544205. The duplicated sequence contains boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively. It duplicates most of the Sox9 TAD and less than half of the Kcnj TAD but leaves the genes intact. The recombination between the loxP sites in the two SBlac cassettes leaves one intact cassette at the duplication junction. Subsequent to the duplication, the allele was subjected to targeting both copies of Rr325 with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in two 18.342 kb deletions (chr11:111413371-111431712 (GRCm39) for the original insulator).
  • mutations:
  • Duplication,
  • Insertion
  • synonyms:
  • Dup-LdeltaBor,
  • Dup-LdeltaBor
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories