|  Help  |  About  |  Contact Us

Allele : Rr516<em1Okud> regulatory region 509; endonuclease-mediated mutation 1, Akihiko Okuda

Primary Identifier  MGI:7711993 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr516
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Max enhancer MUR, located upstream, was targeted using sgRNAs (equivalent to CCCACTGAAACATCGCCCCATGG and TCTTCACAGGCTAAGATCTCAGG) with CRISPR/Cas9 technology, resulting in an ~1.6 kb deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • dMUR,
  • dMUR
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories