|  Help  |  About  |  Contact Us

Allele : Dcp1b<em1(IMPC)J> decapping mRNA 1B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7428749 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dcp1b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGCGCTTCATAACCAAG and TCTTCCTCGTGGGGATACCA, which resulted in a 2545 bp deletion beginning at Chromosome 6 position 119,198,637 bp and ending after 119,201,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254689 and ENSMUSE00001256429 (exons 4 and 5) and 2348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 107.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories