| Primary Identifier | MGI:7428749 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dcp1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGCGCTTCATAACCAAG and TCTTCCTCGTGGGGATACCA, which resulted in a 2545 bp deletion beginning at Chromosome 6 position 119,198,637 bp and ending after 119,201,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254689 and ENSMUSE00001256429 (exons 4 and 5) and 2348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 107. |
