| Primary Identifier | MGI:7388258 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp385c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTCAAGTTCACACAACG and GTCTCATGCCTCATCTAGGA, which resulted in a 257 bp deletion beginning at Chromosome 11 position 100,632,662 bp and ending after 100,632,918 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256338 (exon 4) and 91 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 72 amino acids later. |
