|  Help  |  About  |  Contact Us

Allele : Tg(Rr250407-Luc)3xPKmm transgene insert 3xP, Kenneth M Murphy

Primary Identifier  MGI:7397296 Allele Type  Transgenic
Attribute String  Reporter Gene  Tg(Rr250407-Luc)3xPKmm
Strain of Origin  (BALB/c x B6C3)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The transgene contains the following elements: SV40 transcriptional terminator sequence, three copies of OAP/P1 (octamer-associated protein/P sequence-binding nuclear factor) binding site sequence (CTGGTGTAATAATAAAATTTTCCAATGT) from mouse Il4 promoter/enhancer, Il4 promoter sequence (-58 to + 60 bp with respect to TATA box start), the luciferase gene, and SV40 poly(A) signal sequence. A total of six mouse lines were created (#5, 41, 78, 96, 104, 158), with transgene copy numbers of 5-12.
  • mutations:
  • Insertion
  • synonyms:
  • 3xP Luciferase,
  • 3xP Luciferase
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories