| Primary Identifier | MGI:7397296 | Allele Type | Transgenic |
| Attribute String | Reporter | Gene | Tg(Rr250407-Luc)3xPKmm |
| Strain of Origin | (BALB/c x B6C3)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The transgene contains the following elements: SV40 transcriptional terminator sequence, three copies of OAP/P1 (octamer-associated protein/P sequence-binding nuclear factor) binding site sequence (CTGGTGTAATAATAAAATTTTCCAATGT) from mouse Il4 promoter/enhancer, Il4 promoter sequence (-58 to + 60 bp with respect to TATA box start), the luciferase gene, and SV40 poly(A) signal sequence. A total of six mouse lines were created (#5, 41, 78, 96, 104, 158), with transgene copy numbers of 5-12. |