| Primary Identifier | MGI:7398533 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr325 |
| Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively, was targeted with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in an 18.342 kb deletion (chr11:111413371-111431712 (GRCm39)). |