|  Help  |  About  |  Contact Us

Allele : Del(3)1Jfm deletion, Chr 3, James F Martin 1

Primary Identifier  MGI:7424889 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Del(3)1Jfm
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  The Pitx2 AF (atrial fibrillation)-related enhancer, located upstream of the gene, was targeted with sgRNAs (targeting GTATTTCATCTAAGGCACAG and CATGGTCACAGTCAATGTGC) using CRISPR/Cas9 technology, resulting in an ~18.6 kb deletion. The deleted sequence contains predicted enhancer Rr79124.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Pitx2<delta20k>,
  • Pitx2<delta20k>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories