| Primary Identifier | MGI:7424889 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(3)1Jfm |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Pitx2 AF (atrial fibrillation)-related enhancer, located upstream of the gene, was targeted with sgRNAs (targeting GTATTTCATCTAAGGCACAG and CATGGTCACAGTCAATGTGC) using CRISPR/Cas9 technology, resulting in an ~18.6 kb deletion. The deleted sequence contains predicted enhancer Rr79124. |
