|  Help  |  About  |  Contact Us

Allele : Del(9Rr207839-Rr207840)9Vmc deletion, Chr 9, Vincent M Christoffels 9

Primary Identifier  MGI:7423617 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Del(9Rr207839-Rr207840)9Vmc
Strain of Origin  FVB/NRj Is Recombinase  false
Is Wild Type  false
molecularNote  The super-enhancer between Exog and Scn5a, containing cardiac-specific Scn5a enhancers Rr207838, Rr207839 and Rr207840, was targeted with sgRNAs (targeting GGCACTATTTGAGTTCCACT and GGGAGCCGAGGGCGCTCCTT) using CRISPR/Cas9 technology, resulting in an ~9.9 kb deletion of the sequence containing Rr207839 and Rr207840.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • RE6-8<->,
  • RE6-8<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

2 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories