| Primary Identifier | MGI:7425278 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(6Rr133120)2Pike |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A putative Fgf23 bone enhancer, located ~38 kb upstream, was targeted with sgRNAs (targeting TGGAAGCAAGGGATTTACAG and GAGGCTGACACAGCATGCCT) using CRISPR/Cas9 technology, resulting in a 1071 bp deletion. The deleted sequence contains putative CTCF-binding site Rr133120. |