| Primary Identifier | MGI:7425011 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Alg12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAAAAGTACCTATCACCC and CTGAAAGGAAGTCAGAGGCG, which resulted in a 4434 bp deletion beginning at Chromosome 15 position 88,811,214 bp and ending after 88,815,647 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000312413, ENSMUSE00001295588, ENSMUSE00001230922, and ENSMUSE00001279793 (exons 4-7) and 3737 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 1 amino acid later. |