|  Help  |  About  |  Contact Us

Allele : Alg12<em1(IMPC)J> ALG12 alpha-1,6-mannosyltransferase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7425011 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Alg12
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAAAAGTACCTATCACCC and CTGAAAGGAAGTCAGAGGCG, which resulted in a 4434 bp deletion beginning at Chromosome 15 position 88,811,214 bp and ending after 88,815,647 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000312413, ENSMUSE00001295588, ENSMUSE00001230922, and ENSMUSE00001279793 (exons 4-7) and 3737 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories