|  Help  |  About  |  Contact Us

Allele : Del(6Rr147611)3Pike deletion, Chr 6, J Wesley Pike 3

Primary Identifier  MGI:7425279 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Del(6Rr147611)3Pike
Is Recombinase  false Is Wild Type  false
molecularNote  An Fgf23 bone enhancer, located ~16 kb upstream, was targeted with sgRNAs (targeting GGAGGCGTAAACATCTGATCAGG and CCATGGGCTAGGGTGCGGAATGG) using CRISPR/Cas9 technology, resulting in a 947 bp deletion. The deleted sequence contains putative enhancer Rr147611.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Fgf23<-16KO>,
  • Fgf23<-16KO>,
  • FGF23-16KO,
  • FGF23-16KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

1 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories