| Primary Identifier | MGI:7425279 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(6Rr147611)3Pike |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | An Fgf23 bone enhancer, located ~16 kb upstream, was targeted with sgRNAs (targeting GGAGGCGTAAACATCTGATCAGG and CCATGGGCTAGGGTGCGGAATGG) using CRISPR/Cas9 technology, resulting in a 947 bp deletion. The deleted sequence contains putative enhancer Rr147611. |