|  Help  |  About  |  Contact Us

Allele : Fgf23<em1Pike> fibroblast growth factor 23; endonuclease-mediated mutation 1, J Wesley Pike

Primary Identifier  MGI:7425280 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fgf23
Is Recombinase  false Is Wild Type  false
molecularNote  A putative Fgf23 bone enhancer, located in an Fgf23 intron, was targeted with sgRNAs (targeting TGTCTCTATTATCTGCAGGG and AAACACAAGAAGTTGAGGGC) using CRISPR/Cas9 technology, resulting in a 296 bp deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • FGF23-IKO,
  • FGF23-IKO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories