|  Help  |  About  |  Contact Us

Allele : Calhm4<em1(IMPC)Tcp> calcium homeostasis modulator family member 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7425554 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Calhm4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGTTGCTCGGCTCGATAC and AGAGGGCTGCTTCTCCGGTA traversing the critical region (ENSMUSE00000316881 and ENSMUSE00000371215). This resulted in a 2794-bp deletion of Chr10 from 33,917,226 to 33,920,020 with insertion of TACCC (GRCm39).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories