| Primary Identifier | MGI:7426069 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ubr7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTTCCCTCTTCCGTTATGC targeting the 5' side and GGACTGGTTGGGAGCCTACC targeting the 3' side of a critical region (ENSMUSE00000259884, ENSMUSE00000259878, ENSMUSE00000259867, ENSMUSE00000343370 & ENSMUSE00000115512) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 5,617-bp deletion of Chr12 from 102,727,155 to 102,732,771 (GRCm39) with insertion of the attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGG). |