|  Help  |  About  |  Contact Us

Allele : Igs47<em1(Rr325)Smun> intergenic sequence 47; endonuclease-mediated mutation 1, Stefan Mundlos

Primary Identifier  MGI:7407293 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Igs47
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A 6.3 kb sequence, containing the border (insulator) region between the Kcnj and Sox9 topologically associated domains (TADs), was targeted for insertion in Rr325em1Smun Rr325 deletion allele ES cells about 125 kb upstream of Sox9 with an sgRNA (targeting GGAGGGACACTGATATTTCT) using CRISPR/Cas9 technology.
  • mutations:
  • Insertion
  • synonyms:
  • Bor-Knockin,
  • Bor-Knockin
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories