|  Help  |  About  |  Contact Us

Allele : In(11)3Smun inversion, Chr 11, Stefan Mundlos 3

Primary Identifier  MGI:7407296 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  In(11)3Smun
Is Recombinase  false Is Wild Type  false
molecularNote  The centromeric part of the Sox9 topologically associated domain (TAD), excluding border (insulator) region Rr325 that separates it from the Kcnj TAD, was targeted with sgRNAs (targeting ATTTAGCGTCCCCTAGCATA and GAAGCAAATACGTGAGTCTAC) using CRISPR/Cas9 technology, resulting in its inversion.
  • mutations:
  • Inversion,
  • Insertion
  • synonyms:
  • Inv-Intra,
  • Inv-Intra
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories