|  Help  |  About  |  Contact Us

Allele : Rr331<em1Fsp> regulatory region 331; endonuclease-mediated mutation 1, Francois Spitz

Primary Identifier  MGI:7410981 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr331
Is Recombinase  false Is Wild Type  false
molecularNote  Myc blood enhancer cluster (BENC) sequence C was targeted with sgRNAs (targeting GCTCTGCATTGCCGTTTAAC) and GTAGCTCTTAGGGCCGGAAA) using CRISPR/Cas9 technology, resulting in its deletion (chr15:63519708-63520630 (GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Myc<deltaC>,
  • Myc<deltaC>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories