| Primary Identifier | MGI:7408180 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prr30 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACTCAAGTGATAGCAGT and GAGCACCTGAAGCAGAATCC, which resulted in a 1970 bp deletion beginning at Chromosome 14 position 101,435,012 bp and ending after 101,436,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364724 (exon 3) and 175 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
