| Help | About | Contact Us

Allele : Rr328<em3Mam> regulatory region 328; endonuclease-mediated mutation 3, Lothar Hennighausen

Primary Identifier	MGI:7408216	Allele Type	Endonuclease-mediated
Attribute String	Modified regulatory region	Gene	Rr328
Strain of Origin	C57BL/6	Is Recombinase	false
Is Wild Type	false

description	This mutation occurs with Rr329^em2Mam.
molecularNote	CRISPR-targeting using an sgRNA (targeting TGGAAGGCCACTTCCCAGAA) deleted 16 bp (ACTTCCCAGAAGGGCC), which includes the interferonâactivated sequence (GAS) motif, within the E1 enhancer (part of Wap super enhancer) upstream of Wap.

mutations:
Intragenic deletion

synonyms:
GAS<deltaE1a/2>,
GAS<deltaE1a/2>

earliestPublication:
Shin HY, et al. (2016) Hierarchy within the mammary STAT5-driven Wap super-enhancer. Nat Genet 48(8):904-911

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

0 Carried By

0 Driven By

2 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76812980

MouseMine