|  Help  |  About  |  Contact Us

Allele : Septin2<em1(IMPC)Tcp> septin 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7435545 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Septin2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGTTGATAAGAACGAATA targeting the 5' side and GAACCTCATTGAGTAGGAC targeting the 3' side flanking the critical region to delete exons 5 to 7 ( ENSMUSE00001407774, ENSMUSE00001408284 and ENSMUSE00001412668). This resulted in a 3,394 bp deletion, Chr1:93423975 to 93427368 (GRCm39).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories