| Primary Identifier | MGI:7435545 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Septin2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGTTGATAAGAACGAATA targeting the 5' side and GAACCTCATTGAGTAGGAC targeting the 3' side flanking the critical region to delete exons 5 to 7 ( ENSMUSE00001407774, ENSMUSE00001408284 and ENSMUSE00001412668). This resulted in a 3,394 bp deletion, Chr1:93423975 to 93427368 (GRCm39). |
