| Primary Identifier | MGI:7435546 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc22a7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGACTCCCCCAGACCTCCGT targeting the 5' side and CAGGCGCCCAGGCGCTCCAA targeting the 3' side of a critical region (ENSMUSE00000542695). This resulted in a 368-bp del chr17:46745722 to 46746089 and a 6-bp deletion (GGAGGT) chr17:46746115 to 46746120_insTC on the minus strand (GRCm39). |
