| Primary Identifier | MGI:7435547 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Thnsl2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGTGGCGGAATCTGCTGA targeting the 5' side and CCTTTAACACCGTTGTCATC targeting the 3' side flanking the critical region for an inter-exon deletion (ENSMUSE00001241758 and ENSMUSE00000458023). This resulted in a 1,234-bp deletion of Chr6 from 71,115,673 to 71,116,906 (GRCm39). |
