| Primary Identifier | MGI:7435548 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Thtpa |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCAAACAGCGGUACCU targeting the 5' side and GAAUCAAUGGCAUCGACCAA targeting the 3' side of a critical region (ENSMUSG00000045691.15). This resulted in a 2695-bp deletion chr14:55332584 to 55335278 (GRCm39) which deleted the entire open reading frame. |
