|  Help  |  About  |  Contact Us

Allele : Cd55<em1Cys> CD55 molecule, decay accelerating factor for complement; endonuclease-mediated mutation 1, Jason G Cyster

Primary Identifier  MGI:7427391 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cd55
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-cas9 mediated recombination using guide RNAs (CTGGCATTAGGAATGTCTGG and TCTGTCTTGAAAATGGCCAA) created a 139 bp deletion in exon 2 in the Cd55 gene. The identical sequence was also deleted in the Cd55b gene resulting in Cd55bem1Cysi allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories