| Primary Identifier | MGI:7427391 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cd55 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR-cas9 mediated recombination using guide RNAs (CTGGCATTAGGAATGTCTGG and TCTGTCTTGAAAATGGCCAA) created a 139 bp deletion in exon 2 in the Cd55 gene. The identical sequence was also deleted in the Cd55b gene resulting in Cd55bem1Cysi allele. |