Primary Identifier | MGI:7430786 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cfap20dc |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAAACATTAATTGCAAG and AATTTCACCAGTGCCCCAAG, which resulted in a 442 bp deletion beginning at Chromosome 14 position 8,644,284 bp and ending after 8,644,725 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000305379 (exon 4) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 4 amino acids later. |