| Primary Identifier | MGI:7430792 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pom121l2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCAGCTACCTGGGCAAAG and CTTGTAAGTGTGATGTTTCC, which resulted in a 2881 bp deletion beginning at Chromosome 13 position 21,981,578 bp and ending after 21,984,458 bp (GRCm38/mm10). This mutation deletes 2881 bp from ENSMUSE00000378952 (exon 1) and is predicted to generate a null allele. |
