|  Help  |  About  |  Contact Us

Allele : Krtap29-1<em1(IMPC)J> keratin associated protein 29-1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7430809 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Krtap29-1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATGCCAAGCGGGCACCTA and AGGGCAACAGCTGTCTGCCA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 99,978,042 bp and ending after 99,979,051 bp (GRCm38/mm10). This mutation deletes 1010 bp from ENSMUSE00000665201 (exon 1) and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories