| Primary Identifier | MGI:7430809 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krtap29-1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATGCCAAGCGGGCACCTA and AGGGCAACAGCTGTCTGCCA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 99,978,042 bp and ending after 99,979,051 bp (GRCm38/mm10). This mutation deletes 1010 bp from ENSMUSE00000665201 (exon 1) and is predicted to generate a null allele. |
