| Primary Identifier | MGI:7430813 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppp1r36 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AGTGTATCCTGAGATACACA and ACAAGCCCAGATGATCCAGC, which resulted in a 10249 bp deletion beginning at Chromosome 12 position 76,427,616 bp and ending after 76,437,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000449772, ENSMUSE00000449766, ENSMUSE00000449760, ENSMUSE00000449752, and ENSMUSE00000449748 (exons 4-8) and 9807 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 9 amino acids later. |
