| Primary Identifier | MGI:7435701 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nipsnap3b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTCTCCGAACAAAGAT and CGTCGCTGTTAAGTACACAG, which resulted in a 10,575 bp deletion beginning at Chromosome 4 position 53,011,600 bp and ending after 53,022,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000814213, ENSMUSE00001033419, ENSMUSE00000995530, ENSMUSE00000980454, ENSMUSE00000987062, ENSMUSE00000413885 (exons 1-6) and 9023 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. |
