| Primary Identifier | MGI:7427727 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trim10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTTACTGCCTAACCTTGGG and CTTTTTCTAACAAGGCCTTG, which resulted in a 1354 bp deletion beginning at Chromosome 17 position 36,872,172 bp and ending after 36,873,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000357218 and ENSMUSE00000657361 (exons 3 and 4) and 1100 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 175 and early truncation 1 amino acid later. |
