| Primary Identifier | MGI:7437626 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified isoform(s), Modified regulatory region | Gene | Scn1a |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Evolutionary conserved alternative 5' UTR-containing 1st exon 1b and associated promoter (Rr56937) were targeted with sgRNAs (targeting GGAGATCTGGGTAGTCCTCG and GCTTTTCATACTATAGTGAG) using CRISPR/Cas9 technology, resulting in a 3064 bp deletion (chr2:66237911-66240974 (GRCm39)). |