|  Help  |  About  |  Contact Us

Allele : Scn1a<em1Anord> sodium channel, voltage-gated, type I, alpha; endonuclease-mediated mutation 1, Alexander S Nord

Primary Identifier  MGI:7437626 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s), Modified regulatory region Gene  Scn1a
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Evolutionary conserved alternative 5' UTR-containing 1st exon 1b and associated promoter (Rr56937) were targeted with sgRNAs (targeting GGAGATCTGGGTAGTCCTCG and GCTTTTCATACTATAGTGAG) using CRISPR/Cas9 technology, resulting in a 3064 bp deletion (chr2:66237911-66240974 (GRCm39)).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • 1b<->,
  • Scn1a 1b deletion,
  • 1b<->,
  • Scn1a 1b deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories