| Help | About | Contact Us

Allele : Rr328<em3Hysh> regulatory region 328; endonuclease-mediated mutation 3, Ha Youn Shin

Primary Identifier	MGI:7437889	Allele Type	Endonuclease-mediated
Attribute String	Modified regulatory region	Gene	Rr328
Strain of Origin	C57BL/6	Is Recombinase	false
Is Wild Type	false

molecularNote

CRISPR-targeting enhancer E1 (part of Wap super enhancer) with sgRNAs (targeting CTTCCTTGCAAGAGAAATCA and GTATGGGCCCTTCTGGGAAG) deleted 27 bp (CTTCCCAGAAGGGCCCATACTGTGCCA) encompassing the STAT5-, and NFIB-binding sites.

mutations:
Intergenic deletion

synonyms:
deltaE1C,
deltaE1C

earliestPublication:
Kim U, et al. (2022) Mammary-Enriched Transcription Factors Synergize to Activate the Wap Super-Enhancer for Mammary Gland Development. Int J Mol Sci 23(19)

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

0 Carried By

0 Driven By

2 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76815594

MouseMine