| Primary Identifier | MGI:7437915 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mybph |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGTAGGAACGTCGTAGGT and GGTGGGGAGAGAAGTAGTCG, which resulted in a 1002 bp deletion beginning at Chromosome 1 position 134,124,648 bp and ending after 134,125,649 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000252306, ENSMUSE00000252298 and ENSMUSE00000252292 (exons 4, 5 and 6) and 577 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 175 and early truncation 40 amino acids later. |
