|  Help  |  About  |  Contact Us

Allele : Mybph<em1(IMPC)J> myosin binding protein H; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7437915 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mybph
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGTAGGAACGTCGTAGGT and GGTGGGGAGAGAAGTAGTCG, which resulted in a 1002 bp deletion beginning at Chromosome 1 position 134,124,648 bp and ending after 134,125,649 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000252306, ENSMUSE00000252298 and ENSMUSE00000252292 (exons 4, 5 and 6) and 577 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 175 and early truncation 40 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele