|  Help  |  About  |  Contact Us

Allele : Rr384<em1Srir> regulatory region 384; endonuclease-mediated mutation 1, Sridhar Rao

Primary Identifier  MGI:7439544 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr384
Is Recombinase  false Is Wild Type  false
molecularNote  The Nanog super-enhancer was targeted with sgRNAs (targeting CATGGTCCCTACCACTAGTG and TCAGTGAAAAGTCTTTCACG) using CRISPR/Cas9, resulting in an ~2.5 kb deletion including the enhancer.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • -5-enhancer-deleted,
  • -5-enhancer-deleted
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories