|  Help  |  About  |  Contact Us

Allele : Rr150101<em1Jdai> regulatory region 150101; endonuclease-mediated mutation 1, Jianwu Dai

Primary Identifier  MGI:7440070 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr150101
Is Recombinase  false Is Wild Type  false
molecularNote  Atoh1 enhancer E1 was targeted with sgRNAs (targeting GATTTAGACTCTACACTTGATGG and AGAGATATATTGGAAGGTATAGG) using CRISPR/Cas9 technology, resulting in a 1387 bp deletion (chr6:64740810-64742196 (GRCm39)) including the enhancer.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • E1 KO,
  • E1 KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories