| Primary Identifier | MGI:7443202 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr272 |
| Strain of Origin | (C57BL/6J x DBA/2J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Vsx2 super-enhancer was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in the deletion of super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. The deletion is 31721 bp (chr12:84579817-84611537 (GRCm39)). |