|  Help  |  About  |  Contact Us

Allele : Rr273<em1Issa> regulatory region 273; endonuclease-mediated mutation 1, Issam Aldiri

Primary Identifier  MGI:7443203 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr273
Strain of Origin  (C57BL/6J x DBA/2J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The Vsx2 enhancer, part of super-enhancer Rr272, was targeted with sgRNAs (targeting GTTAGACCTAGTCAGAACTC and TACTTCAGACTCTGGCTCCA) using CRISPR/Cas9 technology, resulting in a 789 bp deletion (chr12:84578820-84579608 (GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • VSX2-EN1-KO,
  • VSX2-EN1-KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories