| Primary Identifier | MGI:7443204 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr258107 |
| Strain of Origin | (C57BL/6J x DBA/2J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Vsx2 CTCF-binding site, located in intron 3, was targeted with sgRNAs (targeting GAGTCTCTAAAAGTAGGAAA and ACCTAATCAAGCAATCAAGT) using CRISPR/Cas9 technology, resulting in a 485 bp deletion (chr12:84636509-84636993 (GRCm39)). |
