|  Help  |  About  |  Contact Us

Allele : Del(6Tas2r143-Tas2r126)7Osb deletion, Chr 6, Research Institute for Microbial Diseases, Osaka University 7

Primary Identifier  MGI:7446748 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(6Tas2r143-Tas2r126)7Osb
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-targeting using sgRNAs AGTGTTTTTGATCCAATAG and TGGAAGTGAGCTCATCTACG deleted the region between Tas2r143 and Tas2r126, which includes Tas2r143, Tas2r135, and Tas2r126. PCR of genomic DNA, RT-qPCR of bone marrow-derived neutrophils, and direct gene sequencing confirmed the deletion of all three genes.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Tas2r126/135/143<->,
  • Tas2r126/135/143<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

3 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories