|  Help  |  About  |  Contact Us

Allele : Del(6Tas2r143-Tas2r126)7Osb deletion, Chr 6, Research Institute for Microbial Diseases, Osaka University 7
Primary Identifier  MGI:7446748 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(6Tas2r143-Tas2r126)7Osb
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-targeting using sgRNAs AGTGTTTTTGATCCAATAG and TGGAAGTGAGCTCATCTACG deleted the region between Tas2r143 and Tas2r126, which includes Tas2r143, Tas2r135, and Tas2r126. PCR of genomic DNA, RT-qPCR of bone marrow-derived neutrophils, and direct gene sequencing confirmed the deletion of all three genes.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Tas2r126/135/143<->,
  • Tas2r126/135/143<->
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Genome

0 Expresses

3 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories





MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom