| Primary Identifier | MGI:7447019 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Actbl2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGCTTTGGTAGTAGATAA and TGTTCATAGAAAATGCTTCT, which resulted in a 1098 bp deletion beginning at Chromosome 13 position 111,255,161 bp and ending after 111,256,258 bp (GRCm38/mm10). This mutation deletes 1098 bp from ENSMUSE00000490725 (exon 1) and is predicted to result in an early termination after amino acid residue 10. |
