| Primary Identifier | MGI:7464198 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klrg1 |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Two guide RNAs (ATTGTGGACCATTCAGCTTG and CTTAACTATGTAGTCCAGAC) are designed to target exon 3. Non-homologus endjoining results in the deletion of the sequence between the gRNAs. Klrg1 transcript Klrg1-201 (ENSMUST00000032207.9) was used as reference for exon number and the guide sequences. |