|  Help  |  About  |  Contact Us

Allele : Got2<em3Pcamp> glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 3, Philippe Campeau

Primary Identifier  MGI:7464273 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Got2
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 6 was targeted with an sgRNA (targeting GGTTGTGAGCGCAGGCATGC) and an ssODN template (ACAGCCAAAAATCTCGATTGTTTCTCCTTAGAAAATCCCAGAGCAGAGTGTCTTATTACACGCATGTGCACACAACCCCACCGGCGTGGACCCGCGTCCCGAGCAGTGGAAGGAGATAGCGTCCG) using CRISPR/Cas9 technology to delete one of leucine codons 207, 208 or 209 (p.L209del). The equivalent human mutation (p.Leu209del, NM_002080.2:c.624_626delTCT) is found in some Malate-Aspartate Shuttle (MAS)-Related Encephalopathy patients.
  • mutations:
  • Nucleotide substitutions,
  • Intragenic deletion
  • synonyms:
  • Got2<emhL209del>,
  • Got2<emhL209del>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories