| Primary Identifier | MGI:7447135 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sema4f |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGGTAGTCACAGTCACGCG and TTCTAGGGATGCTTTCATGG, which resulted in a 554 bp deletion beginning at Chromosome 6 position 82,907,725 bp and ending after 82,908,278 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000194640 (exon 5) and 460 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 8 amino acids later. |