|  Help  |  About  |  Contact Us

Allele : Sema4f<em1(IMPC)J> sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7447135 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sema4f
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGGTAGTCACAGTCACGCG and TTCTAGGGATGCTTTCATGG, which resulted in a 554 bp deletion beginning at Chromosome 6 position 82,907,725 bp and ending after 82,908,278 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000194640 (exon 5) and 460 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele